Transcript: Mouse XR_001778485.1

PREDICTED: Mus musculus component of oligomeric golgi complex 2 (Cog2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cog2 (76332)
Length:
2872
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778485.1
NBCI Gene record:
Cog2 (76332)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778485.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098895 CCCACTTATATGGGCCATCTT pLKO.1 2434 3UTR 100% 4.950 6.930 N Cog2 n/a
2 TRCN0000098898 GCCACAGAGTTTAACCAGCTT pLKO.1 633 3UTR 100% 2.640 3.696 N Cog2 n/a
3 TRCN0000302920 GCCACAGAGTTTAACCAGCTT pLKO_005 633 3UTR 100% 2.640 3.696 N Cog2 n/a
4 TRCN0000098897 CGATGAGATGTTCCTACCTTT pLKO.1 1406 3UTR 100% 4.950 3.465 N Cog2 n/a
5 TRCN0000098896 CCAGAAATACACTGTGAGCAT pLKO.1 1136 3UTR 100% 2.640 1.848 N Cog2 n/a
6 TRCN0000302921 CCAGAAATACACTGTGAGCAT pLKO_005 1136 3UTR 100% 2.640 1.848 N Cog2 n/a
7 TRCN0000098899 GCTATGATTTCTTGGTGAATT pLKO.1 1036 3UTR 100% 0.000 0.000 N Cog2 n/a
8 TRCN0000302919 GCTATGATTTCTTGGTGAATT pLKO_005 1036 3UTR 100% 0.000 0.000 N Cog2 n/a
9 TRCN0000311222 ACTGGGCAGGATGCACCAATA pLKO_005 2653 3UTR 100% 10.800 7.560 N Cog2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778485.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.