Transcript: Mouse XR_001778811.1

PREDICTED: Mus musculus proprotein convertase subtilisin/kexin type 7 (Pcsk7), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcsk7 (18554)
Length:
3426
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778811.1
NBCI Gene record:
Pcsk7 (18554)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778811.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304776 AGTTATGACCTCAACTCTAAT pLKO_005 838 3UTR 100% 13.200 18.480 N Pcsk7 n/a
2 TRCN0000072394 GCACTATCAGATCAATGACAT pLKO.1 1050 3UTR 100% 4.950 6.930 N PCSK7 n/a
3 TRCN0000222467 CAGTGTCTTCTGGACTATTTA pLKO.1 2237 3UTR 100% 15.000 10.500 N Pcsk7 n/a
4 TRCN0000316284 CAGTGTCTTCTGGACTATTTA pLKO_005 2237 3UTR 100% 15.000 10.500 N Pcsk7 n/a
5 TRCN0000222465 CGGGATGTACAGCACATAATT pLKO.1 1507 3UTR 100% 15.000 10.500 N Pcsk7 n/a
6 TRCN0000316205 CGGGATGTACAGCACATAATT pLKO_005 1507 3UTR 100% 15.000 10.500 N Pcsk7 n/a
7 TRCN0000304717 TATGCAGCAAGTCCCTATATA pLKO_005 2857 3UTR 100% 15.000 10.500 N Pcsk7 n/a
8 TRCN0000222466 CGCAGTATCCACTTCAATGAT pLKO.1 643 3UTR 100% 5.625 3.938 N Pcsk7 n/a
9 TRCN0000072396 CTGGACATCTGTCCCTTACTT pLKO.1 1656 3UTR 100% 5.625 3.938 N PCSK7 n/a
10 TRCN0000222464 GCTGGAATTAGCCATCTTCTT pLKO.1 291 3UTR 100% 4.950 3.465 N Pcsk7 n/a
11 TRCN0000349160 GCTGGAATTAGCCATCTTCTT pLKO_005 291 3UTR 100% 4.950 3.465 N Pcsk7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778811.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.