Transcript: Mouse XR_001778919.1

PREDICTED: Mus musculus RRP9, small subunit (SSU) processome component, homolog (yeast) (Rrp9), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rrp9 (27966)
Length:
2151
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778919.1
NBCI Gene record:
Rrp9 (27966)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337738 TAATGCCCGTGTGCGACTTTG pLKO_005 1277 3UTR 100% 10.800 15.120 N Rrp9 n/a
2 TRCN0000193627 CAAGCTCATTCTCATTTGGGA pLKO.1 749 3UTR 100% 0.750 1.050 N Rrp9 n/a
3 TRCN0000176059 GCAGCAAGCTCATTCTCATTT pLKO.1 745 3UTR 100% 13.200 9.240 N Rrp9 n/a
4 TRCN0000337737 GCAGCAAGCTCATTCTCATTT pLKO_005 745 3UTR 100% 13.200 9.240 N Rrp9 n/a
5 TRCN0000173625 GAGTCCCAGCTTGTCTTCTAT pLKO.1 1032 3UTR 100% 5.625 3.938 N Rrp9 n/a
6 TRCN0000337805 GAGTCCCAGCTTGTCTTCTAT pLKO_005 1032 3UTR 100% 5.625 3.938 N Rrp9 n/a
7 TRCN0000194322 CTACCTTGAACAACTCAGGCA pLKO.1 344 3UTR 100% 0.660 0.462 N Rrp9 n/a
8 TRCN0000337879 CTACCTTGAACAACTCAGGCA pLKO_005 344 3UTR 100% 0.660 0.462 N Rrp9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.