Transcript: Mouse XR_001778975.1

PREDICTED: Mus musculus acyl-Coenzyme A dehydrogenase family, member 8 (Acad8), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acad8 (66948)
Length:
1873
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778975.1
NBCI Gene record:
Acad8 (66948)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041687 GCTCGGGAAATGGCTCCCAAT pLKO.1 216 3UTR 100% 1.350 1.890 N Acad8 n/a
2 TRCN0000041684 GCATAGTTGTTGAGAAAGGAA pLKO.1 697 3UTR 100% 3.000 2.400 N Acad8 n/a
3 TRCN0000332692 GCATAGTTGTTGAGAAAGGAA pLKO_005 697 3UTR 100% 3.000 2.400 N Acad8 n/a
4 TRCN0000041683 GCCTGGATGATTGATAGCTTT pLKO.1 435 3UTR 100% 4.950 3.465 N Acad8 n/a
5 TRCN0000332689 GCCTGGATGATTGATAGCTTT pLKO_005 435 3UTR 100% 4.950 3.465 N Acad8 n/a
6 TRCN0000041685 GCTAAACAACAAGGAGATCAT pLKO.1 573 3UTR 100% 4.950 3.465 N Acad8 n/a
7 TRCN0000332690 GCTAAACAACAAGGAGATCAT pLKO_005 573 3UTR 100% 4.950 3.465 N Acad8 n/a
8 TRCN0000041686 CCAGATCCTAGAAGGTAGCAA pLKO.1 1325 3UTR 100% 3.000 2.100 N Acad8 n/a
9 TRCN0000332691 CCAGATCCTAGAAGGTAGCAA pLKO_005 1325 3UTR 100% 3.000 2.100 N Acad8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.