Transcript: Mouse XR_001779017.1

PREDICTED: Mus musculus elongator acetyltransferase complex subunit 6 (Elp6), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Elp6 (72341)
Length:
2309
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779017.1
NBCI Gene record:
Elp6 (72341)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779017.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267117 CAGTCACTGTATACGTTTATT pLKO_005 606 3UTR 100% 15.000 21.000 N Elp6 n/a
2 TRCN0000267114 CTTCTACCTGAAAGCTAATTG pLKO_005 380 3UTR 100% 13.200 18.480 N Elp6 n/a
3 TRCN0000267115 AGTTACTGTAATGCATCTTTG pLKO_005 1903 3UTR 100% 10.800 8.640 N Elp6 n/a
4 TRCN0000267116 TGTCCAGTCCTTCAGCCATTA pLKO_005 422 3UTR 100% 10.800 7.560 N Elp6 n/a
5 TRCN0000267113 TGCTGTTCTGTGACCTGATTT pLKO_005 1138 3UTR 100% 13.200 7.920 N Elp6 n/a
6 TRCN0000177808 CCTGGAACTTGCTATGTAGAT pLKO.1 2045 3UTR 100% 4.950 2.475 Y 2310022A10Rik n/a
7 TRCN0000286002 CCTGGAACTTGCTATGTAGAT pLKO_005 2045 3UTR 100% 4.950 2.475 Y 2310022A10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779017.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.