Transcript: Mouse XR_001779426.1

PREDICTED: Mus musculus protocadherin 15 (Pcdh15), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcdh15 (11994)
Length:
15856
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779426.1
NBCI Gene record:
Pcdh15 (11994)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094901 CCGGAAGAACTGAACCCTATT pLKO.1 2692 3UTR 100% 10.800 15.120 N Pcdh15 n/a
2 TRCN0000094900 CCGTGGTCAATCAACTGGATA pLKO.1 5540 3UTR 100% 4.950 6.930 N Pcdh15 n/a
3 TRCN0000094902 CGGAACCTAATGTGGTCACTT pLKO.1 6875 3UTR 100% 4.950 6.930 N Pcdh15 n/a
4 TRCN0000094899 GCTCTCTCTTTGGCTTGTTAT pLKO.1 8063 3UTR 100% 13.200 9.240 N Pcdh15 n/a
5 TRCN0000094903 CGTGGTCAATCAACTGGATAT pLKO.1 5541 3UTR 100% 10.800 7.560 N Pcdh15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.