Transcript: Mouse XR_001779545.1

PREDICTED: Mus musculus POC1 centriolar protein B (Poc1b), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Poc1b (382406)
Length:
2970
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779545.1
NBCI Gene record:
Poc1b (382406)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779545.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181982 CCCAGGTCTAATTGCAGTAAT pLKO.1 1827 3UTR 100% 13.200 18.480 N Poc1b n/a
2 TRCN0000198219 CTGCACTGTAAAGATCCTAAA pLKO.1 1083 3UTR 100% 10.800 15.120 N Poc1b n/a
3 TRCN0000181374 CGACTGTCTTTGACAGAAGAT pLKO.1 1543 3UTR 100% 4.950 6.930 N Poc1b n/a
4 TRCN0000216947 CCAATAAGCAGTGCGTTAATA pLKO.1 694 3UTR 100% 15.000 10.500 N Poc1b n/a
5 TRCN0000177828 CCAGGTCTAATTGCAGTAATA pLKO.1 1828 3UTR 100% 13.200 9.240 N Poc1b n/a
6 TRCN0000178189 CCTGAAGGTAATGAATGTGTT pLKO.1 2002 3UTR 100% 4.950 3.465 N Poc1b n/a
7 TRCN0000176627 CTGGGATATAAGAATGAACAA pLKO.1 809 3UTR 100% 4.950 3.465 N Poc1b n/a
8 TRCN0000200419 GCAAGGGTGAAGACATCTGTA pLKO.1 1337 3UTR 100% 4.950 3.465 N Poc1b n/a
9 TRCN0000178269 GCACATTATGGAACAACTCAA pLKO.1 1488 3UTR 100% 4.950 3.465 N Poc1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779545.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.