Transcript: Mouse XR_001779899.1

PREDICTED: Mus musculus Meis homeobox 1 (Meis1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Meis1 (17268)
Length:
4758
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779899.1
NBCI Gene record:
Meis1 (17268)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321056 TAGAGAAGGTACACGAATTAT pLKO_005 2916 3UTR 100% 15.000 21.000 N Meis1 n/a
2 TRCN0000012524 CCTCGGTCAATGACGCTTTAA pLKO.1 2634 3UTR 100% 13.200 18.480 N Meis1 n/a
3 TRCN0000320985 GTATGGGACAGCCGAGTTATA pLKO_005 3558 3UTR 100% 13.200 18.480 N Meis1 n/a
4 TRCN0000360331 ATTCACGCTCAGTAGCTTAAG pLKO_005 3773 3UTR 100% 10.800 15.120 N Meis1 n/a
5 TRCN0000321054 TCCTCGGTCAATGACGCTTTA pLKO_005 2633 3UTR 100% 10.800 15.120 N Meis1 n/a
6 TRCN0000012527 GTACACGAATTATGTGACAAT pLKO.1 2924 3UTR 100% 4.950 6.930 N Meis1 n/a
7 TRCN0000012523 CCATATTTGAATTGGCCTGAA pLKO.1 4382 3UTR 100% 4.050 5.670 N Meis1 n/a
8 TRCN0000360330 CAGAAGCCTCCTTACATTAAA pLKO_005 4119 3UTR 100% 15.000 10.500 N Meis1 n/a
9 TRCN0000321055 CAGCCAAGGGACACCTTATAA pLKO_005 3320 3UTR 100% 15.000 10.500 N Meis1 n/a
10 TRCN0000434388 ATGTAACCTTCATCTAGTTAA pLKO_005 3462 3UTR 100% 13.200 9.240 N MEIS1 n/a
11 TRCN0000360401 CAATTTCTGCCACCGGTATAT pLKO_005 2941 3UTR 100% 13.200 9.240 N Meis1 n/a
12 TRCN0000012526 CCATCCTTCAAGTGAACAATT pLKO.1 3238 3UTR 100% 13.200 9.240 N Meis1 n/a
13 TRCN0000320982 TTATCCATATTACGTTGTTTC pLKO_005 4025 3UTR 100% 10.800 7.560 N Meis1 n/a
14 TRCN0000012525 CCAAACAGATTCGCGCAGAAA pLKO.1 2814 3UTR 100% 4.950 3.465 N Meis1 n/a
15 TRCN0000015971 CGGTATATTAGCTGTTTGAAA pLKO.1 2954 3UTR 100% 5.625 3.375 N MEIS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.