Transcript: Mouse XR_001779961.1

PREDICTED: Mus musculus ATP-binding cassette, sub-family A (ABC1), member 5 (Abca5), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abca5 (217265)
Length:
4517
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779961.1
NBCI Gene record:
Abca5 (217265)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000447420 ACACTCCCGTGACTAACATTA pLKO_005 499 3UTR 100% 13.200 10.560 N Abca5 n/a
2 TRCN0000113462 CCGATCATCTTCCCAAGGTTA pLKO.1 547 3UTR 100% 4.950 3.960 N Abca5 n/a
3 TRCN0000443440 GCAACATTAATGGCAATATTA pLKO_005 1615 3UTR 100% 15.000 10.500 N Abca5 n/a
4 TRCN0000439789 CTAACAGAGTGACCGTGTTTA pLKO_005 2242 3UTR 100% 13.200 9.240 N Abca5 n/a
5 TRCN0000443513 TGAAGATGACGAATCCATTAA pLKO_005 4374 3UTR 100% 13.200 9.240 N Abca5 n/a
6 TRCN0000113461 CCAGCCATTATGGTATGCAAT pLKO.1 4135 3UTR 100% 4.950 3.465 N Abca5 n/a
7 TRCN0000113463 CCAGAACATAATGGTGGCAAT pLKO.1 3075 3UTR 100% 4.050 2.835 N Abca5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.