Transcript: Mouse XR_001780056.1

PREDICTED: Mus musculus ubiquitin specific peptidase 36 (Usp36), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp36 (72344)
Length:
3148
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780056.1
NBCI Gene record:
Usp36 (72344)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780056.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030829 CCTGTGATTCTCAGGGAACAA pLKO.1 2354 3UTR 100% 4.950 3.465 N Usp36 n/a
2 TRCN0000327305 CCTGTGATTCTCAGGGAACAA pLKO_005 2354 3UTR 100% 4.950 3.465 N Usp36 n/a
3 TRCN0000030832 GAACGCCTATATGTGTGCTAA pLKO.1 1340 3UTR 100% 4.950 3.465 N Usp36 n/a
4 TRCN0000327303 GAACGCCTATATGTGTGCTAA pLKO_005 1340 3UTR 100% 4.950 3.465 N Usp36 n/a
5 TRCN0000030833 GCGCTGTTGAATGGAGTAGAT pLKO.1 2401 3UTR 100% 4.950 3.465 N Usp36 n/a
6 TRCN0000327302 GCGCTGTTGAATGGAGTAGAT pLKO_005 2401 3UTR 100% 4.950 3.465 N Usp36 n/a
7 TRCN0000030830 GCCTGAAGTTACAGAACGGAT pLKO.1 1943 3UTR 100% 2.640 1.848 N Usp36 n/a
8 TRCN0000327322 GCCTGAAGTTACAGAACGGAT pLKO_005 1943 3UTR 100% 2.640 1.848 N Usp36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780056.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.