Transcript: Mouse XR_001780124.1

PREDICTED: Mus musculus predicted gene 11677 (Gm11677), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm11677 (629967)
Length:
1016
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780124.1
NBCI Gene record:
Gm11677 (629967)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239752 ACAGGAGAGACGCCATATAAG pLKO_005 208 3UTR 100% 13.200 7.920 N Gm11677 n/a
2 TRCN0000239756 ACAGGAGAGAAGCCATATAAG pLKO_005 40 3UTR 100% 13.200 6.600 Y Gm11677 n/a
3 TRCN0000239754 GAGAAACCTTATGAGTGTAAT pLKO_005 130 3UTR 100% 13.200 6.600 Y Gm11677 n/a
4 TRCN0000265667 CTGGAGCTTGAGCCTTCATAG pLKO_005 423 3UTR 100% 10.800 5.400 Y Zfp93 n/a
5 TRCN0000239755 GTGGGAAGCGCTTCAGCTTAA pLKO_005 155 3UTR 100% 10.800 5.400 Y Gm11677 n/a
6 TRCN0000239753 GAAGCCATTTCACTGCAATTG pLKO_005 300 3UTR 100% 10.800 6.480 N Gm11677 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.