Transcript: Mouse XR_001780448.1

PREDICTED: Mus musculus phosphofurin acidic cluster sorting protein 2 (Pacs2), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pacs2 (217893)
Length:
2525
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780448.1
NBCI Gene record:
Pacs2 (217893)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250359 ATCTTGACGAGGACGACTTTG pLKO_005 719 3UTR 100% 10.800 15.120 N Pacs2 n/a
2 TRCN0000168619 GCAACAGAACTTCAAGCAGAA pLKO.1 798 3UTR 100% 4.050 5.670 N PACS2 n/a
3 TRCN0000250358 TCCACCAGGTCAGAATCAAAG pLKO_005 1321 3UTR 100% 10.800 7.560 N Pacs2 n/a
4 TRCN0000250356 TCTTGAGATCACATGAGATTG pLKO_005 278 3UTR 100% 10.800 7.560 N Pacs2 n/a
5 TRCN0000137443 GACCAGGCAACAGAACTTCAA pLKO.1 792 3UTR 100% 4.950 3.465 N PACS2 n/a
6 TRCN0000250357 AGCGATACTGCAACTGCAATT pLKO_005 1673 3UTR 100% 10.800 6.480 N Pacs2 n/a
7 TRCN0000135103 CACCAAGGAGAAGAACAAGAA pLKO.1 2482 3UTR 100% 4.950 2.970 N PACS2 n/a
8 TRCN0000134533 GAAGAACAAGAAGGTGATGTT pLKO.1 2491 3UTR 100% 4.950 2.970 N PACS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.