Transcript: Mouse XR_001780449.1

PREDICTED: Mus musculus WD repeat domain 60 (Wdr60), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr60 (217935)
Length:
5272
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780449.1
NBCI Gene record:
Wdr60 (217935)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192207 CCGTGAGAAAGACAAGCTAAA pLKO.1 498 3UTR 100% 10.800 15.120 N Wdr60 n/a
2 TRCN0000200755 GTTGGCGAGTTATCTTTGAAA pLKO.1 1318 3UTR 100% 5.625 3.938 N Wdr60 n/a
3 TRCN0000191802 GAGAAAGAAGATACCGAGAAA pLKO.1 758 3UTR 100% 4.950 3.465 N Wdr60 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.