Transcript: Mouse XR_001780485.1

PREDICTED: Mus musculus family with sequence similarity 71, member D (Fam71d), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam71d (70897)
Length:
2105
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780485.1
NBCI Gene record:
Fam71d (70897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780485.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182786 CGTAGGCATCTGTTCTTCCAA pLKO.1 786 3UTR 100% 3.000 4.200 N Fam71d n/a
2 TRCN0000216393 GATCACAGATGTTCAAGATAT pLKO.1 1341 3UTR 100% 13.200 9.240 N Fam71d n/a
3 TRCN0000423395 ACACACAGATACCCTTGTAAC pLKO_005 1234 3UTR 100% 10.800 7.560 N Fam71d n/a
4 TRCN0000215888 CAAAGAAATATGTGATGAAAC pLKO.1 1674 3UTR 100% 10.800 7.560 N Fam71d n/a
5 TRCN0000217837 CTGTCACCATGTCAAACATAG pLKO.1 1583 3UTR 100% 10.800 7.560 N Fam71d n/a
6 TRCN0000200116 CCTCCTATACTGGAGAGCAAT pLKO.1 703 3UTR 100% 4.950 3.465 N Fam71d n/a
7 TRCN0000421196 TGCTAAGAACATGCGTCTCAA pLKO_005 972 3UTR 100% 4.950 3.465 N Fam71d n/a
8 TRCN0000181506 GAATAAGCAAGAAGCCCTCTT pLKO.1 609 3UTR 100% 4.050 2.835 N Fam71d n/a
9 TRCN0000182273 GCATCTGTTCTTCCAATCCCA pLKO.1 791 3UTR 100% 0.750 0.525 N Fam71d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780485.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.