Transcript: Mouse XR_001780499.1

PREDICTED: Mus musculus zinc finger CCCH type containing 14 (Zc3h14), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zc3h14 (75553)
Length:
2464
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780499.1
NBCI Gene record:
Zc3h14 (75553)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194227 GCAGCGTAGAAGACACTTATA pLKO.1 949 3UTR 100% 13.200 18.480 N Zc3h14 n/a
2 TRCN0000216150 CAAGCTAACAAGAATCTAATT pLKO.1 1194 3UTR 100% 13.200 10.560 N Zc3h14 n/a
3 TRCN0000215959 CTCTGAAGATGTGATTGATAT pLKO.1 650 3UTR 100% 13.200 9.240 N Zc3h14 n/a
4 TRCN0000341256 GACTGAGCCCTCTAGTCTAAA pLKO_005 380 3UTR 100% 13.200 9.240 N Zc3h14 n/a
5 TRCN0000341194 GTATGGCTCCATGGTGTATTA pLKO_005 339 3UTR 100% 13.200 9.240 N Zc3h14 n/a
6 TRCN0000128105 CCGTTACTTCCCTGCTTGTAA pLKO.1 2032 3UTR 100% 5.625 3.938 N ZC3H14 n/a
7 TRCN0000343697 CCGTTACTTCCCTGCTTGTAA pLKO_005 2032 3UTR 100% 5.625 3.938 N ZC3H14 n/a
8 TRCN0000128765 CCAGGATACATGTCAGATCAA pLKO.1 1574 3UTR 100% 4.950 3.465 N ZC3H14 n/a
9 TRCN0000193981 GCCTTCAAACAAGAGCAGTTT pLKO.1 434 3UTR 100% 4.950 3.465 N Zc3h14 n/a
10 TRCN0000176300 CGACTGCAAATTGATCCAGTA pLKO.1 1455 3UTR 100% 4.050 2.835 N Zc3h14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.