Transcript: Mouse XR_001780504.1

PREDICTED: Mus musculus RIKEN cDNA 4930447C04 gene (4930447C04Rik), transcript variant X15, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
4930447C04Rik (75801)
Length:
2693
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780504.1
NBCI Gene record:
4930447C04Rik (75801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246527 CTAGATCACCTGGACTAAATT pLKO_005 1339 3UTR 100% 15.000 21.000 N 4930447C04Rik n/a
2 TRCN0000216436 GGACATTATACGTAGTTAATT pLKO.1 744 3UTR 100% 15.000 21.000 N 4930447C04Rik n/a
3 TRCN0000216759 GAACATTACTCTGCGGTAAAT pLKO.1 1410 3UTR 100% 13.200 10.560 N 4930447C04Rik n/a
4 TRCN0000246529 GAACATTACTCTGCGGTAAAT pLKO_005 1410 3UTR 100% 13.200 10.560 N 4930447C04Rik n/a
5 TRCN0000246526 TAAGCTACGTGAAGCTATAAA pLKO_005 349 3UTR 100% 15.000 10.500 N 4930447C04Rik n/a
6 TRCN0000179564 GCCATGTGAGTCTCAGAAATT pLKO.1 1030 3UTR 100% 13.200 9.240 N 4930447C04Rik n/a
7 TRCN0000178997 CATCAGACTCTTCTCACACAT pLKO.1 1513 3UTR 100% 4.950 3.465 N 4930447C04Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.