Transcript: Mouse XR_001780791.1

PREDICTED: Mus musculus phosphofructokinase, platelet (Pfkp), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pfkp (56421)
Length:
10163
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780791.1
NBCI Gene record:
Pfkp (56421)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274765 TCGGAATGGTGATATCGATAA pLKO_005 557 3UTR 100% 10.800 15.120 N Pfkp n/a
2 TRCN0000025948 GCAATCTATGACGGCTTTGAA pLKO.1 1443 3UTR 100% 5.625 7.875 N Pfkp n/a
3 TRCN0000274764 TGACGGAGTCAGCAGTAATAA pLKO_005 9982 3UTR 100% 15.000 12.000 N Pfkp n/a
4 TRCN0000025894 GCAGAAGTATTCCTACCTCAA pLKO.1 587 3UTR 100% 4.050 3.240 N Pfkp n/a
5 TRCN0000274698 ACGAAAGCTGCAGTGTAAATT pLKO_005 9432 3UTR 100% 15.000 10.500 N Pfkp n/a
6 TRCN0000025916 GCCATTTGATATCGGAGATTT pLKO.1 9343 3UTR 100% 13.200 9.240 N Pfkp n/a
7 TRCN0000274701 GCCATTTGATATCGGAGATTT pLKO_005 9343 3UTR 100% 13.200 9.240 N Pfkp n/a
8 TRCN0000025962 GCGAGCTATGACATGTCTGAT pLKO.1 9815 3UTR 100% 4.950 3.465 N Pfkp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.