Transcript: Mouse XR_001781148.1

PREDICTED: Mus musculus myelin basic protein expression factor 2, repressor (Myef2), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myef2 (17876)
Length:
8422
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781148.1
NBCI Gene record:
Myef2 (17876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337470 TTGGACCGCAATGCGTAATTT pLKO_005 1466 3UTR 100% 15.000 21.000 N Myef2 n/a
2 TRCN0000011995 CATGTAATGTTTGCAGAGATA pLKO.1 1322 3UTR 100% 4.950 3.465 N Myef2 n/a
3 TRCN0000011994 GCTGAACATAACTGGTGTAAT pLKO.1 727 3UTR 100% 13.200 6.600 Y Myef2 n/a
4 TRCN0000337469 GCTGAACATAACTGGTGTAAT pLKO_005 727 3UTR 100% 13.200 6.600 Y Myef2 n/a
5 TRCN0000011997 GCCAATCGGTTCCATCCTTAT pLKO.1 305 3UTR 100% 10.800 5.400 Y Myef2 n/a
6 TRCN0000337467 GCCAATCGGTTCCATCCTTAT pLKO_005 305 3UTR 100% 10.800 5.400 Y Myef2 n/a
7 TRCN0000011996 GCAACCAGATATTTGTTAGAA pLKO.1 1245 3UTR 100% 5.625 2.813 Y Myef2 n/a
8 TRCN0000011993 GCAGGCTATTAAAGATTTGAT pLKO.1 415 3UTR 100% 5.625 2.813 Y Myef2 n/a
9 TRCN0000337468 GCAGGCTATTAAAGATTTGAT pLKO_005 415 3UTR 100% 5.625 2.813 Y Myef2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.