Transcript: Mouse XR_001781240.1

PREDICTED: Mus musculus uncharacterized LOC101056159 (LOC101056159), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC101056159 (101056159)
Length:
720
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781240.1
NBCI Gene record:
LOC101056159 (101056159)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023061 CCTGAAAGAATGCAATCAATT pLKO.1 474 3UTR 100% 13.200 6.600 Y LOC382881 n/a
2 TRCN0000181565 GAGACCAGCAAGAACATACAT pLKO.1 595 3UTR 100% 5.625 2.813 Y Gm9732 n/a
3 TRCN0000192160 CACAACATGAGAAGACAATGT pLKO.1 353 3UTR 100% 4.950 2.475 Y Gm3696 n/a
4 TRCN0000198694 CCTCCTGAAAGAATGCAATCA pLKO.1 471 3UTR 100% 4.950 2.475 Y Gm9732 n/a
5 TRCN0000176722 CATAGAAGATAAGGATTCCTA pLKO.1 432 3UTR 100% 3.000 1.500 Y 4930503E14Rik n/a
6 TRCN0000181474 CTACCTCCTGAAAGAATGCAA pLKO.1 468 3UTR 100% 3.000 1.500 Y Gm9732 n/a
7 TRCN0000191111 GAATGCAATCAATTGAAGGAA pLKO.1 481 3UTR 100% 3.000 1.500 Y 1700024B05Rik n/a
8 TRCN0000023063 GCAGTCAATAAGTGATACCAT pLKO.1 393 3UTR 100% 3.000 1.500 Y LOC382881 n/a
9 TRCN0000192311 CAGCAAGAACATACATCCCAA pLKO.1 600 3UTR 100% 2.640 1.320 Y Gm5622 n/a
10 TRCN0000182095 GAGAACAGAAAGCTGCTGGTA pLKO.1 523 3UTR 100% 2.640 1.320 Y Gm9732 n/a
11 TRCN0000177404 GCAAGAACATACATCCCAAAT pLKO.1 602 3UTR 100% 10.800 5.400 Y Gm9732 n/a
12 TRCN0000177036 GAAGACAATGTTGGATATGAA pLKO.1 363 3UTR 100% 5.625 2.813 Y Gm10128 n/a
13 TRCN0000201292 GAACATACATCCCAAGTGCAA pLKO.1 606 3UTR 100% 2.640 1.320 Y Gm5622 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.