Transcript: Mouse XR_001781561.1

PREDICTED: Mus musculus leucine-rich repeat kinase 2 (Lrrk2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrrk2 (66725)
Length:
10899
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781561.1
NBCI Gene record:
Lrrk2 (66725)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322256 AGACATCCTCGTCACTATATT pLKO_005 10353 3UTR 100% 15.000 21.000 N Lrrk2 n/a
2 TRCN0000322193 GGCCGAGTTGTGGATCATATT pLKO_005 5797 3UTR 100% 13.200 18.480 N Lrrk2 n/a
3 TRCN0000322191 GGCTTACTACTTCACGATATT pLKO_005 6643 3UTR 100% 13.200 18.480 N Lrrk2 n/a
4 TRCN0000022656 CGCAGCTTTCAGCGATTCTAA pLKO.1 7503 3UTR 100% 5.625 7.875 N Lrrk2 n/a
5 TRCN0000322254 CGCAGCTTTCAGCGATTCTAA pLKO_005 7503 3UTR 100% 5.625 7.875 N Lrrk2 n/a
6 TRCN0000022655 GCTTACTACTTCACGATATTT pLKO.1 6644 3UTR 100% 15.000 10.500 N Lrrk2 n/a
7 TRCN0000022654 GCCCTGTATATTGCCAAGAAA pLKO.1 7549 3UTR 100% 5.625 3.938 N Lrrk2 n/a
8 TRCN0000022658 GCTGCCATCATTGCGAAGATT pLKO.1 6490 3UTR 100% 5.625 3.938 N Lrrk2 n/a
9 TRCN0000022657 CCTAAGAACATCATTGTTGAA pLKO.1 6904 3UTR 100% 4.950 3.465 N Lrrk2 n/a
10 TRCN0000322192 TCCACTTTGCAGCGCTTTAAA pLKO_005 2362 3UTR 100% 15.000 9.000 N Lrrk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.