Transcript: Mouse XR_001781780.1

PREDICTED: Mus musculus WAP four-disulfide core domain 5 (Wfdc5), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wfdc5 (209232)
Length:
610
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781780.1
NBCI Gene record:
Wfdc5 (209232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781780.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113208 CGATGGACTCTGCAACCAGAA pLKO.1 195 3UTR 100% 4.050 3.240 N Wfdc5 n/a
2 TRCN0000113207 TCTTTGTAAAGTCGGGCAAAT pLKO.1 308 3UTR 100% 10.800 7.560 N Wfdc5 n/a
3 TRCN0000113209 CCTCCTGATCAGTGCTTGAAT pLKO.1 220 3UTR 100% 5.625 3.938 N Wfdc5 n/a
4 TRCN0000113206 GCCTGTTGCCTTGTGTAGAAA pLKO.1 141 3UTR 100% 5.625 3.375 N Wfdc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781780.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.