Transcript: Mouse XR_001781808.1

PREDICTED: Mus musculus spindle and centriole associated protein 1 (Spice1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spice1 (212514)
Length:
2486
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781808.1
NBCI Gene record:
Spice1 (212514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184333 GTGCCAGTGAAGTGTCTACTA pLKO.1 2092 3UTR 100% 4.950 6.930 N Spice1 n/a
2 TRCN0000179908 CGGTACCTTAAAGAGAGTGAA pLKO.1 1255 3UTR 100% 0.000 0.000 N Spice1 n/a
3 TRCN0000322527 ATCAACTGTGGACTGATATTC pLKO_005 764 3UTR 100% 13.200 10.560 N Spice1 n/a
4 TRCN0000350689 CAGTGAAGTGTCTACTAATTT pLKO_005 2096 3UTR 100% 15.000 10.500 N Spice1 n/a
5 TRCN0000350734 GAGGTTTCTTCACCAACTAAA pLKO_005 720 3UTR 100% 13.200 9.240 N Spice1 n/a
6 TRCN0000184640 CCTGCCTATTGATCCAGACAT pLKO.1 1718 3UTR 100% 4.950 3.465 N Spice1 n/a
7 TRCN0000322461 TGAGGCAAGAATGGGATAATA pLKO_005 188 3UTR 100% 15.000 9.000 N Spice1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.