Transcript: Mouse XR_001781845.1

PREDICTED: Mus musculus kalirin, RhoGEF kinase (Kalrn), transcript variant X18, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kalrn (545156)
Length:
20939
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781845.1
NBCI Gene record:
Kalrn (545156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196857 GTGATGATCTTGACCCTAATA pLKO.1 12863 3UTR 100% 13.200 18.480 N KALRN n/a
2 TRCN0000001427 GCACAATTAGATGACAAGTTT pLKO.1 15099 3UTR 100% 5.625 7.875 N KALRN n/a
3 TRCN0000001430 CAAAGATTACTATGCACTGAA pLKO.1 11892 3UTR 100% 4.950 6.930 N KALRN n/a
4 TRCN0000024366 TCGAGTGAAGCTCATCGACTT pLKO.1 13971 3UTR 100% 4.050 5.670 N Kalrn n/a
5 TRCN0000026864 GCACCGGAAACTGCACTATTT pLKO.1 13298 3UTR 100% 13.200 10.560 N LOC385625 n/a
6 TRCN0000026880 CCGTTTCTCTATTGTAAAGAA pLKO.1 13596 3UTR 100% 5.625 4.500 N LOC385625 n/a
7 TRCN0000024364 CATTTGGACATAAAGCCCGAA pLKO.1 13918 3UTR 100% 2.160 1.728 N Kalrn n/a
8 TRCN0000024368 GTTCTGACATATGTCATGCTT pLKO.1 14119 3UTR 100% 0.000 0.000 N Kalrn n/a
9 TRCN0000026939 CCACATCCTACATCCTGATTT pLKO.1 13766 3UTR 100% 13.200 9.240 N LOC385625 n/a
10 TRCN0000234368 CTTCAGGACACACGAAATATG pLKO_005 9455 3UTR 100% 13.200 9.240 N KALRN n/a
11 TRCN0000024367 CCAGGGATTTCATCAACGTAA pLKO.1 14249 3UTR 100% 4.950 3.465 N Kalrn n/a
12 TRCN0000024365 CCCTTCTTAGATGAGAGCAAA pLKO.1 14152 3UTR 100% 4.950 3.465 N Kalrn n/a
13 TRCN0000026922 GCATCCACATCTGCTACAGTT pLKO.1 13186 3UTR 100% 4.950 3.465 N LOC385625 n/a
14 TRCN0000026869 GCCACCATTTCTTGGAAGGAA pLKO.1 13531 3UTR 100% 3.000 2.100 N LOC385625 n/a
15 TRCN0000001429 GTGGAGTTAATGTGCCTTGTT pLKO.1 11179 3UTR 100% 4.950 6.930 N KALRN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.