Transcript: Mouse XR_001782031.1

PREDICTED: Mus musculus CD2-associated protein (Cd2ap), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd2ap (12488)
Length:
5520
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782031.1
NBCI Gene record:
Cd2ap (12488)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191539 GATGAGTTAACTATCCGAGTT pLKO.1 440 3UTR 100% 4.050 5.670 N Cd2ap n/a
2 TRCN0000250360 CAAACCTAAACCCAGATATTT pLKO_005 3321 3UTR 100% 15.000 10.500 N Cd2ap n/a
3 TRCN0000250364 GAACTTAGAGCCCAGATTATT pLKO_005 2218 3UTR 100% 15.000 10.500 N Cd2ap n/a
4 TRCN0000250363 GACGTTGATGGCAAGATTAAA pLKO_005 1181 3UTR 100% 15.000 10.500 N Cd2ap n/a
5 TRCN0000192452 CGAACTTAGAGCCCAGATTAT pLKO.1 2217 3UTR 100% 13.200 9.240 N Cd2ap n/a
6 TRCN0000250362 GAGAAGGCCATGCGAAGTAAT pLKO_005 2317 3UTR 100% 13.200 9.240 N Cd2ap n/a
7 TRCN0000192649 GCCAGTATTTGCCCTTGATAT pLKO.1 4945 3UTR 100% 13.200 9.240 N Cd2ap n/a
8 TRCN0000250361 AGGGTGAACTGAACGGTAAAG pLKO_005 1323 3UTR 100% 10.800 7.560 N Cd2ap n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2828 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 2854 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.