Transcript: Mouse XR_001782079.1

PREDICTED: Mus musculus mitogen-activated protein kinase kinase kinase 4 (Map3k4), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map3k4 (26407)
Length:
7973
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782079.1
NBCI Gene record:
Map3k4 (26407)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025298 GCAGATCGCTTAAAGTTCTTT pLKO.1 622 3UTR 100% 5.625 7.875 N Map3k4 n/a
2 TRCN0000078956 GTCAAGGTTTGCACAGATGAA pLKO.1 7468 3UTR 100% 4.950 3.960 N LOC433718 n/a
3 TRCN0000245281 AGCACGTCATCAGGTTATATA pLKO_005 4262 3UTR 100% 15.000 10.500 N Map3k4 n/a
4 TRCN0000361598 GATCACTACTGTATGTAATAT pLKO_005 7539 3UTR 100% 15.000 10.500 N Map3k4 n/a
5 TRCN0000025296 CCTTACGTCATCTGGACTAAT pLKO.1 4362 3UTR 100% 13.200 9.240 N Map3k4 n/a
6 TRCN0000025297 GCTCCTGATGAAGCAGTATTA pLKO.1 1944 3UTR 100% 13.200 9.240 N Map3k4 n/a
7 TRCN0000245282 GTGACAGTGCTGAGGTTAAAG pLKO_005 7659 3UTR 100% 13.200 9.240 N Map3k4 n/a
8 TRCN0000245279 TCAGGCTTCCCATAGCTTAAA pLKO_005 2106 3UTR 100% 13.200 9.240 N Map3k4 n/a
9 TRCN0000245278 TGAGCAGGTGAAGCGGATAAT pLKO_005 1017 3UTR 100% 13.200 9.240 N Map3k4 n/a
10 TRCN0000245280 TTTGGGTTTGAGTATCATAAA pLKO_005 3082 3UTR 100% 13.200 9.240 N Map3k4 n/a
11 TRCN0000361600 AGAGTGTAAAGAGGTCCTAAA pLKO_005 1917 3UTR 100% 10.800 7.560 N Map3k4 n/a
12 TRCN0000361599 GCCATGAAGGAGATTCGATTT pLKO_005 4060 3UTR 100% 10.800 7.560 N Map3k4 n/a
13 TRCN0000361597 TAGTAGTGTGTGGACAGAATC pLKO_005 7514 3UTR 100% 10.800 7.560 N Map3k4 n/a
14 TRCN0000078955 CTGGAAAGTGACCCGAAGATA pLKO.1 7411 3UTR 100% 5.625 3.938 N LOC433718 n/a
15 TRCN0000025295 CCAGTGGAGTTCTCTGACTTT pLKO.1 1657 3UTR 100% 4.950 3.465 N Map3k4 n/a
16 TRCN0000025294 GCAGTATGTTAAGGTACAGAT pLKO.1 2502 3UTR 100% 4.950 3.465 N Map3k4 n/a
17 TRCN0000078954 GCATGAGTATGAACACAACTT pLKO.1 7302 3UTR 100% 4.950 3.465 N LOC433718 n/a
18 TRCN0000078957 GTATGAACACAACTTTCAGAT pLKO.1 7308 3UTR 100% 4.950 3.465 N LOC433718 n/a
19 TRCN0000361673 ACCAAAGAAATAACCCATTAT pLKO_005 2155 3UTR 100% 13.200 7.920 N Map3k4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.