Transcript: Mouse XR_001782368.1

PREDICTED: Mus musculus neuropilin (NRP) and tolloid (TLL)-like 1 (Neto1), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Neto1 (246317)
Length:
2951
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782368.1
NBCI Gene record:
Neto1 (246317)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087559 CCCACCACGATCCAAGATTTA pLKO.1 1702 3UTR 100% 13.200 10.560 N Neto1 n/a
2 TRCN0000087561 CGAGAGTGTGTCTACATCATA pLKO.1 1274 3UTR 100% 5.625 3.938 N Neto1 n/a
3 TRCN0000063556 GCAACCAAGAAAGGAACAGAA pLKO.1 1142 3UTR 100% 4.950 3.465 N NETO1 n/a
4 TRCN0000063557 TCTGCCTCATTGGGTCTCTAA pLKO.1 2512 3UTR 100% 4.950 3.465 N NETO1 n/a
5 TRCN0000087560 GCAAGTTTAATCATCCTCCAT pLKO.1 1112 3UTR 100% 2.640 1.848 N Neto1 n/a
6 TRCN0000087562 GTCTCCCAATTATCCCAGCAA pLKO.1 1240 3UTR 100% 2.640 1.848 N Neto1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.