Transcript: Mouse XR_001782372.1

PREDICTED: Mus musculus RIKEN cDNA 4930503L19 gene (4930503L19Rik), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
4930503L19Rik (269033)
Length:
3134
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782372.1
NBCI Gene record:
4930503L19Rik (269033)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264830 TGACGTTAAGTATCCAATTTG pLKO_005 945 3UTR 100% 13.200 18.480 N 4930503L19Rik n/a
2 TRCN0000202205 CCGCAATAAACAGTCACCACA pLKO.1 2048 3UTR 100% 2.640 3.696 N 4930503L19Rik n/a
3 TRCN0000201228 GAAGATGAATATCGCCCTATA pLKO.1 1027 3UTR 100% 10.800 8.640 N 4930503L19Rik n/a
4 TRCN0000264828 TCACAAGGCCTTACAACATTT pLKO_005 1950 3UTR 100% 13.200 9.240 N 4930503L19Rik n/a
5 TRCN0000264831 GAGTATGAAGGATTAGGTAAT pLKO_005 1144 3UTR 100% 10.800 7.560 N 4930503L19Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.