Transcript: Mouse XR_001782400.1

PREDICTED: Mus musculus haloacid dehalogenase-like hydrolase domain containing 2 (Hdhd2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hdhd2 (76987)
Length:
2545
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782400.1
NBCI Gene record:
Hdhd2 (76987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081104 CCGAAACTTAATCGAGCAGAA pLKO.1 354 3UTR 100% 4.050 5.670 N Hdhd2 n/a
2 TRCN0000375476 GGTTCGGTTTGTGACCAATAC pLKO_005 240 3UTR 100% 10.800 8.640 N Hdhd2 n/a
3 TRCN0000359312 AGGCGCACAGGAAGCTCTTAA pLKO_005 195 3UTR 100% 13.200 9.240 N HDHD2 n/a
4 TRCN0000366759 AGGCGCACAGGAAGCTCTTAA pLKO_005 195 3UTR 100% 13.200 9.240 N Hdhd2 n/a
5 TRCN0000375477 TGGACTGGCACCAGAGCATTT pLKO_005 462 3UTR 100% 10.800 7.560 N Hdhd2 n/a
6 TRCN0000366620 TTGGCATGCTGGGCATCTTAG pLKO_005 764 3UTR 100% 10.800 7.560 N Hdhd2 n/a
7 TRCN0000375474 CGTCATGATAGGAGACGATTG pLKO_005 714 3UTR 100% 6.000 4.200 N Hdhd2 n/a
8 TRCN0000081107 CTGAGTTCACAGGAGTTCAAA pLKO.1 416 3UTR 100% 5.625 3.938 N Hdhd2 n/a
9 TRCN0000081106 CCCTCTGATAGCTATCCACAA pLKO.1 531 3UTR 100% 4.050 2.835 N Hdhd2 n/a
10 TRCN0000375475 TTGTGACTGCCTTAGAGTATG pLKO_005 602 3UTR 100% 10.800 6.480 N Hdhd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.