Transcript: Mouse XR_001782581.1

PREDICTED: Mus musculus structural maintenance of chromosomes 5 (Smc5), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smc5 (226026)
Length:
5803
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782581.1
NBCI Gene record:
Smc5 (226026)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782581.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217100 CAGGGTATGGACCCAATTAAT pLKO.1 3189 3UTR 100% 15.000 21.000 N Smc5 n/a
2 TRCN0000241748 TCAGGGTATGGACCCAATTAA pLKO_005 3188 3UTR 100% 15.000 21.000 N Smc5 n/a
3 TRCN0000241749 TCATATCTTCGGGAGTTATTT pLKO_005 1786 3UTR 100% 15.000 21.000 N Smc5 n/a
4 TRCN0000217198 CCCATAATGCTCACGATTAAT pLKO.1 1546 3UTR 100% 15.000 12.000 N Smc5 n/a
5 TRCN0000241750 CCCATAATGCTCACGATTAAT pLKO_005 1546 3UTR 100% 15.000 12.000 N Smc5 n/a
6 TRCN0000241751 ACGGAGTGTGAGTGATCATAT pLKO_005 1401 3UTR 100% 13.200 9.240 N Smc5 n/a
7 TRCN0000183425 CCCAAACACATTGGATGAAAT pLKO.1 2705 3UTR 100% 13.200 9.240 N Smc5 n/a
8 TRCN0000183537 GTCAAGAAGATATGGAGATTT pLKO.1 1643 3UTR 100% 13.200 9.240 N Smc5 n/a
9 TRCN0000147918 GAGGTGAAAGAAGTGTTTCTA pLKO.1 3100 3UTR 100% 5.625 3.938 N SMC5 n/a
10 TRCN0000353776 GAGGTGAAAGAAGTGTTTCTA pLKO_005 3100 3UTR 100% 5.625 3.938 N SMC5 n/a
11 TRCN0000147348 GAGAAAGAATTGAACGGGTAA pLKO.1 1886 3UTR 100% 4.050 2.835 N SMC5 n/a
12 TRCN0000183636 GAGTTATTTGATGCACCTGAT pLKO.1 1798 3UTR 100% 4.050 2.835 N Smc5 n/a
13 TRCN0000241747 GGAACTTCAGCAGGCATTAAC pLKO_005 1155 3UTR 100% 13.200 7.920 N Smc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782581.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.