Transcript: Mouse XR_001782598.1

PREDICTED: Mus musculus acyl-CoA synthetase long-chain family member 5 (Acsl5), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acsl5 (433256)
Length:
3622
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782598.1
NBCI Gene record:
Acsl5 (433256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782598.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112484 CAGGTGGATGTTCAATTACAT pLKO.1 2115 3UTR 100% 5.625 7.875 N Acsl5 n/a
2 TRCN0000335253 CAGGTGGATGTTCAATTACAT pLKO_005 2115 3UTR 100% 5.625 7.875 N Acsl5 n/a
3 TRCN0000112481 CGACTCCTTAACAGGGTCTAT pLKO.1 1826 3UTR 100% 4.950 6.930 N Acsl5 n/a
4 TRCN0000112482 CCAGATTCACTTCCCTCATTT pLKO.1 2537 3UTR 100% 13.200 9.240 N Acsl5 n/a
5 TRCN0000335318 CCAGATTCACTTCCCTCATTT pLKO_005 2537 3UTR 100% 13.200 9.240 N Acsl5 n/a
6 TRCN0000112483 GACCAATTTGTTGGCATCTTT pLKO.1 1163 3UTR 100% 5.625 3.938 N Acsl5 n/a
7 TRCN0000335317 GACCAATTTGTTGGCATCTTT pLKO_005 1163 3UTR 100% 5.625 3.938 N Acsl5 n/a
8 TRCN0000112480 CAGTAAATGAAGCAAGCACTA pLKO.1 3417 3UTR 100% 4.050 2.835 N Acsl5 n/a
9 TRCN0000335255 CAGTAAATGAAGCAAGCACTA pLKO_005 3417 3UTR 100% 4.050 2.835 N Acsl5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782598.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.