Transcript: Mouse XR_001782733.1

PREDICTED: Mus musculus dystrophin related protein 2 (Drp2), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Drp2 (13497)
Length:
8070
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782733.1
NBCI Gene record:
Drp2 (13497)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108703 GCCACAACCTTAAAGAATAAA pLKO.1 3330 3UTR 100% 15.000 21.000 N Drp2 n/a
2 TRCN0000440354 CTGACACACACTCTCGAATTG pLKO_005 3466 3UTR 100% 10.800 15.120 N Drp2 n/a
3 TRCN0000428203 GCATACTCTGGAACATCTATT pLKO_005 1195 3UTR 100% 13.200 10.560 N Drp2 n/a
4 TRCN0000108704 GCTGAGCAAGTGAAGCATCAA pLKO.1 3123 3UTR 100% 4.950 3.960 N Drp2 n/a
5 TRCN0000108702 CGCCTGGATCTGGTAACTTTA pLKO.1 1763 3UTR 100% 13.200 9.240 N Drp2 n/a
6 TRCN0000429460 GGACTTTGCCACAACCTTAAA pLKO_005 3323 3UTR 100% 13.200 9.240 N DRP2 n/a
7 TRCN0000108701 GCCATGAATCTGTGTTGGAAT pLKO.1 746 3UTR 100% 4.950 3.465 N Drp2 n/a
8 TRCN0000420450 TATCCAAGCCATCAAGCTATT pLKO_005 1327 3UTR 100% 10.800 6.480 N Drp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.