Transcript: Mouse XR_001783115.1

PREDICTED: Mus musculus double homeobox family member 3 (Duxf3), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Duxf3 (74399)
Length:
4013
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783115.1
NBCI Gene record:
Duxf3 (74399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096007 CCCTGGAGGAAGCAGCAAATT pLKO.1 2014 3UTR 100% 13.200 6.600 Y LOC435214 n/a
2 TRCN0000235284 CCCTGGAGGAAGCAGCAAATT pLKO_005 2014 3UTR 100% 13.200 6.600 Y Dux n/a
3 TRCN0000235281 CCGAGGACACGATCCACATAT pLKO_005 1297 3UTR 100% 13.200 6.600 Y Dux n/a
4 TRCN0000262745 ACTCCTCCTCCTTGATCAACT pLKO_005 1892 3UTR 100% 4.950 2.475 Y Dux n/a
5 TRCN0000262747 CAAGAAGATGCCCGCACTCAA pLKO_005 1848 3UTR 100% 4.950 2.475 Y Dux n/a
6 TRCN0000096006 CACAGGAAGAAGCAGGAAGTA pLKO.1 1465 3UTR 100% 4.950 2.475 Y LOC435214 n/a
7 TRCN0000096008 TGGTTTCAGAACCGCAGGAAT pLKO.1 1035 3UTR 100% 4.950 2.475 Y LOC435214 n/a
8 TRCN0000096005 CGATCCACATATGGTTTCAAA pLKO.1 1306 3UTR 100% 0.000 0.000 Y LOC435214 n/a
9 TRCN0000262746 TACCTCGATCCCTAGCATCTG pLKO_005 2045 3UTR 100% 0.000 0.000 Y Dux n/a
10 TRCN0000239699 CCTGGAGGAAGCAGCAAATTT pLKO_005 2015 3UTR 100% 15.000 7.500 Y Duxf3 n/a
11 TRCN0000281564 CAGGCCCTGCTATCAACTTTC pLKO_005 933 3UTR 100% 10.800 5.400 Y Dux n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.