Transcript: Mouse XR_001783188.1

PREDICTED: Mus musculus coiled-coil domain containing 3 (Ccdc3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc3 (74186)
Length:
7572
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783188.1
NBCI Gene record:
Ccdc3 (74186)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258163 TAGCCGAGACCATCGTGTATG pLKO_005 449 3UTR 100% 10.800 15.120 N Ccdc3 n/a
2 TRCN0000217436 GGTCCAGGACTACTCTTATTT pLKO.1 675 3UTR 100% 15.000 10.500 N Ccdc3 n/a
3 TRCN0000252009 TAGAGTCTAACTGGGTAAATT pLKO_005 1270 3UTR 100% 15.000 10.500 N Ccdc3 n/a
4 TRCN0000252010 CTTGCCACACGGAGTCAATTT pLKO_005 729 3UTR 100% 13.200 9.240 N Ccdc3 n/a
5 TRCN0000252007 TGGTCCAGGACTACTCTTATT pLKO_005 674 3UTR 100% 13.200 9.240 N Ccdc3 n/a
6 TRCN0000252008 TGTAAGGATGGATGAGAATTA pLKO_005 702 3UTR 100% 13.200 9.240 N Ccdc3 n/a
7 TRCN0000190840 GCCTCTTTAAGCAGTGCTATT pLKO.1 2615 3UTR 100% 10.800 7.560 N Ccdc3 n/a
8 TRCN0000201910 CAAGAAGGTCAAGAGGTCTCT pLKO.1 996 3UTR 100% 2.640 1.584 N Ccdc3 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2111 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.