Transcript: Mouse XR_001783190.1

PREDICTED: Mus musculus apoptosis, caspase activation inhibitor (Aven), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aven (74268)
Length:
1424
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783190.1
NBCI Gene record:
Aven (74268)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120338 ACTAGATATGTTGCTGCATTT pLKO.1 987 3UTR 100% 10.800 15.120 N Aven n/a
2 TRCN0000120339 GAACTAGATATGTTGCTGCAT pLKO.1 985 3UTR 100% 2.640 2.112 N Aven n/a
3 TRCN0000120341 CAGAATTGATCCAGACCACAA pLKO.1 755 3UTR 100% 4.050 2.835 N Aven n/a
4 TRCN0000120337 GAAGCAAATGCTGGTTGCCTT pLKO.1 1248 3UTR 100% 2.640 1.848 N Aven n/a
5 TRCN0000120340 GAATTGATCCAGACCACAATT pLKO.1 757 3UTR 100% 1.320 0.792 N Aven n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.