Transcript: Mouse XR_001784143.1

PREDICTED: Mus musculus transmembrane protein 245 (Tmem245), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem245 (242474)
Length:
3026
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784143.1
NBCI Gene record:
Tmem245 (242474)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784143.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283785 TGCAAGCACTCAACGGTATTT pLKO_005 749 3UTR 100% 13.200 18.480 N Tmem245 n/a
2 TRCN0000268764 ATTAACGAAACTCTAGCAAAT pLKO_005 1617 3UTR 100% 10.800 15.120 N Tmem245 n/a
3 TRCN0000268715 GCCTAGAAGGAGCAATCATTG pLKO_005 2513 3UTR 100% 10.800 7.560 N Tmem245 n/a
4 TRCN0000338732 AGCGGACTTTCCGTGACATTT pLKO_005 2648 3UTR 100% 13.200 9.240 N TMEM245 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784143.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.