Transcript: Mouse XR_001784160.1

PREDICTED: Mus musculus CUB and Sushi multiple domains 2 (Csmd2), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Csmd2 (329942)
Length:
13068
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784160.1
NBCI Gene record:
Csmd2 (329942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087219 GCTGGCTATAATGTTGGACAA pLKO.1 5950 3UTR 100% 4.050 3.240 N LOC433758 n/a
2 TRCN0000087593 CAGCTCCGCTATGAGACTATT pLKO.1 2227 3UTR 100% 13.200 9.240 N LOC381556 n/a
3 TRCN0000087594 GCGTGTTCTTTACTTTCCATA pLKO.1 2549 3UTR 100% 4.950 3.465 N LOC381556 n/a
4 TRCN0000087595 CTCCATGTCCTATGAGGGATT pLKO.1 2727 3UTR 100% 4.050 2.835 N LOC381556 n/a
5 TRCN0000087221 CCACGATAGCATCGTGTACTT pLKO.1 5820 3UTR 100% 0.495 0.347 N LOC433758 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.