Transcript: Mouse XR_001784168.2

PREDICTED: Mus musculus WD repeat containing, antisense to Trp73 (Wrap73), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Wrap73 (59002)
Length:
1648
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784168.2
NBCI Gene record:
Wrap73 (59002)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784168.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437704 TCCTGTGTCCAGTACCGATTA pLKO_005 160 3UTR 100% 10.800 15.120 N Wrap73 n/a
2 TRCN0000424940 CTGTATCTTACATCAAGTATC pLKO_005 461 3UTR 100% 10.800 8.640 N Wrap73 n/a
3 TRCN0000193852 CCTGAACACAACCGAATTTCA pLKO.1 405 3UTR 100% 5.625 4.500 N Wrap73 n/a
4 TRCN0000421697 AGCATACTGTGCCTATGAATG pLKO_005 732 3UTR 100% 10.800 7.560 N Wrap73 n/a
5 TRCN0000194546 GTCTGGATCTGGGACATTCAA pLKO.1 1184 3UTR 100% 5.625 3.938 N Wrap73 n/a
6 TRCN0000173227 CATTGGGAGCTACGATGGAAA pLKO.1 804 3UTR 100% 4.950 3.465 N Wrap73 n/a
7 TRCN0000176379 CCTGGCATCAAGAAATGACAA pLKO.1 1150 3UTR 100% 4.950 3.465 N Wrap73 n/a
8 TRCN0000175338 CCTTCAGATCCTTCAGTTGTA pLKO.1 201 3UTR 100% 4.950 3.465 N Wrap73 n/a
9 TRCN0000175173 CTGGAAGATGATAACTGAGTT pLKO.1 849 3UTR 100% 4.950 3.465 N Wrap73 n/a
10 TRCN0000176257 CTGTTTGTGGTACTAGAGCAT pLKO.1 1214 3UTR 100% 2.640 1.848 N Wrap73 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784168.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.