Transcript: Mouse XR_001784199.1

PREDICTED: Mus musculus tRNA methyltransferase 10B (Trmt10b), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trmt10b (69934)
Length:
1528
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784199.1
NBCI Gene record:
Trmt10b (69934)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039160 CCATCAACCAAGTGTTCGATA pLKO.1 1039 3UTR 100% 4.950 6.930 N Trmt10b n/a
2 TRCN0000308866 CCATCAACCAAGTGTTCGATA pLKO_005 1039 3UTR 100% 4.950 6.930 N Trmt10b n/a
3 TRCN0000039159 CCTTAACCAAAGAGAAACTTT pLKO.1 491 3UTR 100% 5.625 4.500 N Trmt10b n/a
4 TRCN0000308786 CCTTAACCAAAGAGAAACTTT pLKO_005 491 3UTR 100% 5.625 4.500 N Trmt10b n/a
5 TRCN0000039163 GAAACTCGTAACTGGCCTGAA pLKO.1 1077 3UTR 100% 4.050 3.240 N Trmt10b n/a
6 TRCN0000308865 GAAACTCGTAACTGGCCTGAA pLKO_005 1077 3UTR 100% 4.050 3.240 N Trmt10b n/a
7 TRCN0000434644 GACAGATTCGAAGGTTGTATG pLKO_005 599 3UTR 100% 10.800 7.560 N TRMT10B n/a
8 TRCN0000039161 GTCTCCTCAAAGAAGAGCAAA pLKO.1 379 3UTR 100% 4.950 3.465 N Trmt10b n/a
9 TRCN0000308785 GTCTCCTCAAAGAAGAGCAAA pLKO_005 379 3UTR 100% 4.950 3.465 N Trmt10b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784199.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.