Transcript: Mouse XR_001784202.1

PREDICTED: Mus musculus transmembrane protein 68 (Tmem68), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem68 (72098)
Length:
2391
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784202.1
NBCI Gene record:
Tmem68 (72098)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305320 CTCATTAGCAGATAGCTTAAT pLKO_005 1183 3UTR 100% 13.200 18.480 N Tmem68 n/a
2 TRCN0000305384 TTAGGTGATCCCATACCATAT pLKO_005 1029 3UTR 100% 10.800 15.120 N Tmem68 n/a
3 TRCN0000124567 GCCCTATGTGACCTGTATGAT pLKO.1 306 3UTR 100% 5.625 7.875 N Tmem68 n/a
4 TRCN0000305383 CGGCTGTTTGGCATGGTTATG pLKO_005 572 3UTR 100% 10.800 8.640 N Tmem68 n/a
5 TRCN0000124564 GCAGCCAGTAACGTGGTTATT pLKO.1 2104 3UTR 100% 13.200 9.240 N Tmem68 n/a
6 TRCN0000331928 GCAGCCAGTAACGTGGTTATT pLKO_005 2104 3UTR 100% 13.200 9.240 N Tmem68 n/a
7 TRCN0000124565 CCGCTATCCATTTGCTCCAAT pLKO.1 974 3UTR 100% 4.950 3.465 N Tmem68 n/a
8 TRCN0000309306 CCGCTATCCATTTGCTCCAAT pLKO_005 974 3UTR 100% 4.950 3.465 N Tmem68 n/a
9 TRCN0000124566 CCTCCATATCTACAAGAGGAA pLKO.1 471 3UTR 100% 2.640 1.848 N Tmem68 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.