Transcript: Mouse XR_001784218.2

PREDICTED: Mus musculus transmembrane and coiled-coil domains 4 (Tmco4), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Tmco4 (77056)
Length:
4003
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784218.2
NBCI Gene record:
Tmco4 (77056)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784218.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126954 CCAGACTTCTGTATGCAACTT pLKO.1 3372 3UTR 100% 4.950 6.930 N Tmco4 n/a
2 TRCN0000126958 CGGCAGATACCGCACATTTAA pLKO.1 2258 3UTR 100% 15.000 12.000 N Tmco4 n/a
3 TRCN0000446934 AGGTGCCAATGAGACACTTTG pLKO_005 3728 3UTR 100% 10.800 7.560 N Tmco4 n/a
4 TRCN0000416859 CACTCAAGAATGGACACTATG pLKO_005 1762 3UTR 100% 10.800 7.560 N Tmco4 n/a
5 TRCN0000126955 CCGACATCTTTGCTCAGACTT pLKO.1 1678 3UTR 100% 4.950 3.465 N Tmco4 n/a
6 TRCN0000128110 CCTGACAGGATACAAGATGAA pLKO.1 2141 3UTR 100% 4.950 3.465 N TMCO4 n/a
7 TRCN0000126957 GCTGTTATGACTTCACTGTTT pLKO.1 2103 3UTR 100% 4.950 3.465 N Tmco4 n/a
8 TRCN0000126956 GCTACATATCACCATTGCCAT pLKO.1 2219 3UTR 100% 2.640 1.848 N Tmco4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784218.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.