Transcript: Mouse XR_001784584.2

PREDICTED: Mus musculus solute carrier family 15, member 4 (Slc15a4), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Slc15a4 (100561)
Length:
4076
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784584.2
NBCI Gene record:
Slc15a4 (100561)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069182 CATTGGCATCAGTGAGATATT pLKO.1 1655 3UTR 100% 13.200 10.560 N Slc15a4 n/a
2 TRCN0000303091 CATTGGCATCAGTGAGATATT pLKO_005 1655 3UTR 100% 13.200 10.560 N Slc15a4 n/a
3 TRCN0000069180 GCAGGAATCCTGGAGAGTAAA pLKO.1 1530 3UTR 100% 13.200 9.240 N Slc15a4 n/a
4 TRCN0000303064 GCAGGAATCCTGGAGAGTAAA pLKO_005 1530 3UTR 100% 13.200 9.240 N Slc15a4 n/a
5 TRCN0000069178 CCACCTGCATTACTACTTCTT pLKO.1 1865 3UTR 100% 4.950 3.465 N Slc15a4 n/a
6 TRCN0000303090 CCACCTGCATTACTACTTCTT pLKO_005 1865 3UTR 100% 4.950 3.465 N Slc15a4 n/a
7 TRCN0000069179 CCTCATTGTGTCTGTGAAGTA pLKO.1 1925 3UTR 100% 4.950 3.465 N Slc15a4 n/a
8 TRCN0000303020 CCTCATTGTGTCTGTGAAGTA pLKO_005 1925 3UTR 100% 4.950 3.465 N Slc15a4 n/a
9 TRCN0000069181 CCAGAGTGTCTTCATCACCAA pLKO.1 1020 3UTR 100% 2.640 1.848 N Slc15a4 n/a
10 TRCN0000331870 CCAGAGTGTCTTCATCACCAA pLKO_005 1020 3UTR 100% 2.640 1.848 N Slc15a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.