Transcript: Mouse XR_001784626.1

PREDICTED: Mus musculus general transcription factor II I (Gtf2i), transcript variant X35, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gtf2i (14886)
Length:
4857
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784626.1
NBCI Gene record:
Gtf2i (14886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784626.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304427 ACTCATCACCCAACGTTAATA pLKO_005 2683 3UTR 100% 15.000 21.000 N Gtf2i n/a
2 TRCN0000304428 CCAAGTGGGCAATCGAATTAA pLKO_005 1769 3UTR 100% 15.000 12.000 N Gtf2i n/a
3 TRCN0000304426 CCTCGCCTTGAGAGGATATTG pLKO_005 1434 3UTR 100% 13.200 10.560 N Gtf2i n/a
4 TRCN0000086099 CCCAGTAACAGAAGAAATTAA pLKO.1 3710 3UTR 100% 15.000 10.500 N Gtf2i n/a
5 TRCN0000364550 ATGGGAAAGCTTTAGGCAAAT pLKO_005 754 3UTR 100% 10.800 7.560 N GTF2I n/a
6 TRCN0000086098 CCTGTGCTAGTCAGTGCTTTA pLKO.1 4157 3UTR 100% 10.800 7.560 N Gtf2i n/a
7 TRCN0000315959 CCTGTGCTAGTCAGTGCTTTA pLKO_005 4157 3UTR 100% 10.800 7.560 N Gtf2i n/a
8 TRCN0000086100 CCCAATGATCTCTATGTGGAA pLKO.1 1680 3UTR 100% 2.640 1.848 N Gtf2i n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784626.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.