Transcript: Mouse XR_001784660.1

PREDICTED: Mus musculus transforming, acidic coiled-coil containing protein 3 (Tacc3), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tacc3 (21335)
Length:
3345
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784660.1
NBCI Gene record:
Tacc3 (21335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312793 AGAACCTGTCGTGGATCTAAA pLKO_005 1398 3UTR 100% 13.200 18.480 N Tacc3 n/a
2 TRCN0000082056 CCAACTTAATGCAGACCTGAA pLKO.1 2608 3UTR 100% 4.050 5.670 N Tacc3 n/a
3 TRCN0000311854 CCAACTTAATGCAGACCTGAA pLKO_005 2608 3UTR 100% 4.050 5.670 N Tacc3 n/a
4 TRCN0000082053 CCCATTTATTTCCTTATCTGT pLKO.1 3233 3UTR 100% 3.000 2.400 N Tacc3 n/a
5 TRCN0000082054 GCAGTCTTTGTACGTGAAATT pLKO.1 1524 3UTR 100% 13.200 9.240 N Tacc3 n/a
6 TRCN0000311792 GCAGTCTTTGTACGTGAAATT pLKO_005 1524 3UTR 100% 13.200 9.240 N Tacc3 n/a
7 TRCN0000296701 GTTTGGAACTTCCTCGTTTAA pLKO_005 1485 3UTR 100% 13.200 9.240 N TACC3 n/a
8 TRCN0000312811 GTTTGGAACTTCCTCGTTTAA pLKO_005 1485 3UTR 100% 13.200 9.240 N Tacc3 n/a
9 TRCN0000082055 GCTGAGCTTGTCAACTTAGAT pLKO.1 1651 3UTR 100% 5.625 3.938 N Tacc3 n/a
10 TRCN0000311793 GCTGAGCTTGTCAACTTAGAT pLKO_005 1651 3UTR 100% 5.625 3.938 N Tacc3 n/a
11 TRCN0000082057 ACTTAGATTTCTTGGGAGATT pLKO.1 1664 3UTR 100% 4.950 3.465 N Tacc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.