Transcript: Mouse XR_001784688.1

PREDICTED: Mus musculus Ras association and DIL domains (Radil), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Radil (231858)
Length:
3881
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784688.1
NBCI Gene record:
Radil (231858)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784688.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264810 TCCGAGTATTTGGCGACAATG pLKO_005 794 3UTR 100% 10.800 15.120 N Radil n/a
2 TRCN0000283188 CTCACGTTGAGGACACCTTTG pLKO_005 3728 3UTR 100% 6.000 8.400 N Radil n/a
3 TRCN0000264809 CTTTCCAGCAGTGCGTGTATT pLKO_005 2058 3UTR 100% 13.200 10.560 N Radil n/a
4 TRCN0000201067 CACCCACTATAAGAGTGTCTT pLKO.1 627 3UTR 100% 4.950 3.960 N Radil n/a
5 TRCN0000264812 TGTACAGGCACCCACTATAAG pLKO_005 619 3UTR 100% 13.200 9.240 N Radil n/a
6 TRCN0000264811 GGACACTGAGCTACAAGTATC pLKO_005 491 3UTR 100% 10.800 7.560 N Radil n/a
7 TRCN0000202494 GAAGGAGATGCGATTCAGGAT pLKO.1 3191 3UTR 100% 2.640 1.584 N Radil n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784688.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.