Transcript: Mouse XR_001784725.1

PREDICTED: Mus musculus RUN and FYVE domain containing 3 (Rufy3), transcript variant X15, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rufy3 (52822)
Length:
7650
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784725.1
NBCI Gene record:
Rufy3 (52822)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784725.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120985 GATGCCAATTTCTGCATGAAA pLKO.1 1071 3UTR 100% 5.625 7.875 N Rufy3 n/a
2 TRCN0000430128 ACCTTAAATAGTGCAGCAAAT pLKO_005 1782 3UTR 100% 10.800 8.640 N RUFY3 n/a
3 TRCN0000120986 CGATGCCAATTTCTGCATGAA pLKO.1 1070 3UTR 100% 4.950 3.960 N Rufy3 n/a
4 TRCN0000430811 CATTTAAGCTCTGATTCTATA pLKO_005 1901 3UTR 100% 13.200 9.240 N RUFY3 n/a
5 TRCN0000120984 CCTTAAATAGTGCAGCAAATA pLKO.1 1783 3UTR 100% 13.200 9.240 N Rufy3 n/a
6 TRCN0000120983 CGACCCATGAAGATCCCAATT pLKO.1 583 3UTR 100% 10.800 7.560 N Rufy3 n/a
7 TRCN0000120982 GCCCAAGATAAGGGTTTAGTA pLKO.1 2337 3UTR 100% 5.625 3.938 N Rufy3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784725.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.