Transcript: Mouse XR_001785091.1

PREDICTED: Mus musculus ELKS/RAB6-interacting/CAST family member 1 (Erc1), transcript variant X12, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Erc1 (111173)
Length:
8790
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785091.1
NBCI Gene record:
Erc1 (111173)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785091.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241500 ACGCTTGCCTTACGGTGTTAG pLKO_005 1035 3UTR 100% 10.800 15.120 N Erc1 n/a
2 TRCN0000241503 GAGGAGATGCACCGGAGATTT pLKO_005 1831 3UTR 100% 13.200 10.560 N Erc1 n/a
3 TRCN0000157886 CCAGAGATGAGTGACCGAATA pLKO.1 2854 3UTR 100% 10.800 8.640 N ERC1 n/a
4 TRCN0000191551 GATGCTAACATAGCTCTTCTA pLKO.1 3358 3UTR 100% 4.950 3.960 N Erc1 n/a
5 TRCN0000215603 GAGAATATACAGTCCTTAAAT pLKO.1 916 3UTR 100% 15.000 10.500 N Erc1 n/a
6 TRCN0000215661 GTCCATTGTTGAGAATATTAA pLKO.1 7686 3UTR 100% 15.000 10.500 N Erc1 n/a
7 TRCN0000241501 ACGGACAATTGAACGCTTAAA pLKO_005 2541 3UTR 100% 13.200 9.240 N Erc1 n/a
8 TRCN0000241499 GCGGCTCAAGACCCTAGAAAT pLKO_005 2745 3UTR 100% 13.200 9.240 N Erc1 n/a
9 TRCN0000241502 GGTCACCCTGATCGCTCTTTA pLKO_005 4490 3UTR 100% 13.200 9.240 N Erc1 n/a
10 TRCN0000200934 CCGTCTCTTGGAAATCTTGAA pLKO.1 2940 3UTR 100% 4.950 3.465 N Erc1 n/a
11 TRCN0000157836 CCCTAAATGCTCGGGATGAAT pLKO.1 1649 3UTR 100% 5.625 3.375 N ERC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785091.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.