Transcript: Mouse XR_001785117.1

PREDICTED: Mus musculus solute carrier family 6 (neurotransmitter transporter, taurine), member 6 (Slc6a6), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc6a6 (21366)
Length:
6506
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785117.1
NBCI Gene record:
Slc6a6 (21366)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271666 TGCGTTCCTCATACCGTATTT pLKO_005 547 3UTR 100% 13.200 18.480 N Slc6a6 n/a
2 TRCN0000271729 TTCGTTCAACGGAACCTTAAA pLKO_005 4211 3UTR 100% 13.200 18.480 N Slc6a6 n/a
3 TRCN0000079839 CGTGAGAATCAAATACCTGAT pLKO.1 2353 3UTR 100% 4.050 5.670 N Slc6a6 n/a
4 TRCN0000079840 CGACGCTGGAACTCAGATATT pLKO.1 1192 3UTR 100% 13.200 9.240 N Slc6a6 n/a
5 TRCN0000271727 GCTATAACAAGTACAAGTATA pLKO_005 1257 3UTR 100% 13.200 9.240 N Slc6a6 n/a
6 TRCN0000271667 GGTCCAGCAAGATCGACTTTG pLKO_005 447 3UTR 100% 10.800 7.560 N Slc6a6 n/a
7 TRCN0000079842 CCTGACCTACAACAAAGTGTA pLKO.1 2221 3UTR 100% 4.950 3.465 N Slc6a6 n/a
8 TRCN0000079838 GCCAACAAGAAAGATGCCAAA pLKO.1 3137 3UTR 100% 4.050 2.835 N Slc6a6 n/a
9 TRCN0000271728 GCTACGCATCCATCGTCATTG pLKO_005 687 3UTR 100% 10.800 6.480 N Slc6a6 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6206 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13956 pDONR223 100% 8.2% None (many diffs) n/a
2 ccsbBroad304_13956 pLX_304 0% 8.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV