Transcript: Mouse XR_001785154.1

PREDICTED: Mus musculus coatomer protein complex, subunit gamma 2 (Copg2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Copg2 (54160)
Length:
3425
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785154.1
NBCI Gene record:
Copg2 (54160)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785154.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312898 TGAGAGCTGCTTGCGAAATAA pLKO_005 1083 3UTR 100% 15.000 21.000 N Copg2 n/a
2 TRCN0000312897 TCCGGGATTGTGACCCTAATA pLKO_005 2504 3UTR 100% 13.200 18.480 N Copg2 n/a
3 TRCN0000100685 GCATGAGCTTTAGAGTTTCTT pLKO.1 3156 3UTR 100% 5.625 7.875 N Copg2 n/a
4 TRCN0000311917 GCATGAGCTTTAGAGTTTCTT pLKO_005 3156 3UTR 100% 5.625 7.875 N Copg2 n/a
5 TRCN0000380489 GTGAGTGCTTTGGCTAAATTT pLKO_005 1792 3UTR 100% 15.000 10.500 N COPG2 n/a
6 TRCN0000312899 ACTCGATTGTTTCAATCTAAT pLKO_005 538 3UTR 100% 13.200 9.240 N Copg2 n/a
7 TRCN0000100688 CCTTACAATCAGCCAGGAATA pLKO.1 2404 3UTR 100% 10.800 7.560 N Copg2 n/a
8 TRCN0000100689 CCTGCAATCTGGACTTAGAAA pLKO.1 1289 3UTR 100% 5.625 3.938 N Copg2 n/a
9 TRCN0000311916 CCTGCAATCTGGACTTAGAAA pLKO_005 1289 3UTR 100% 5.625 3.938 N Copg2 n/a
10 TRCN0000100687 GCCTGCAATCTGGACTTAGAA pLKO.1 1288 3UTR 100% 5.625 3.938 N Copg2 n/a
11 TRCN0000100686 CCCTCTATCTAGCAGGTGTAT pLKO.1 2834 3UTR 100% 4.950 3.465 N Copg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785154.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.