Transcript: Mouse XR_001785523.1

PREDICTED: Mus musculus RAS guanyl releasing protein 4 (Rasgrp4), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rasgrp4 (233046)
Length:
5054
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785523.1
NBCI Gene record:
Rasgrp4 (233046)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785523.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077675 GAGGAATGTATCCGCTGCTTT pLKO.1 2792 3UTR 100% 4.950 6.930 N Rasgrp4 n/a
2 TRCN0000077676 GAAGCAGTCATAAGCCGGTTT pLKO.1 3032 3UTR 100% 4.050 5.670 N Rasgrp4 n/a
3 TRCN0000077674 GATCTCTTCTACACGGAAGAT pLKO.1 3845 3UTR 100% 0.495 0.693 N Rasgrp4 n/a
4 TRCN0000431037 TGCACCTACCCAAGCTGAATA pLKO_005 3726 3UTR 100% 13.200 9.240 N Rasgrp4 n/a
5 TRCN0000428262 CCATCTCTCTGGAGGACTTTG pLKO_005 4059 3UTR 100% 10.800 7.560 N Rasgrp4 n/a
6 TRCN0000416036 GCGGAAAGTGTCATTGCTATT pLKO_005 3175 3UTR 100% 10.800 7.560 N Rasgrp4 n/a
7 TRCN0000077677 CCAAGAGCTAAGACAGCTACA pLKO.1 2944 3UTR 100% 4.050 2.835 N Rasgrp4 n/a
8 TRCN0000077673 CCACAACAACTATGCCCACTA pLKO.1 3592 3UTR 100% 4.050 2.835 N Rasgrp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785523.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.