Transcript: Mouse XR_001785530.1

PREDICTED: Mus musculus transmembrane channel-like gene family 3 (Tmc3), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmc3 (233424)
Length:
3489
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785530.1
NBCI Gene record:
Tmc3 (233424)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785530.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069055 CCTTCAATACTCCGTCCTGTT pLKO.1 1408 3UTR 100% 4.050 5.670 N Tmc3 n/a
2 TRCN0000069511 CAGCTTCATCGTTCTCTTAAA pLKO.1 1522 3UTR 100% 13.200 9.240 N LOC381971 n/a
3 TRCN0000069057 CCAGAATATACAGTTTCAGAA pLKO.1 955 3UTR 100% 4.950 3.465 N Tmc3 n/a
4 TRCN0000069510 CGTCCTGTTCTACGGGTACTA pLKO.1 1420 3UTR 100% 4.950 3.465 N LOC381971 n/a
5 TRCN0000069054 GCCACATACAAAGGCCAACAA pLKO.1 2245 3UTR 100% 4.950 3.465 N Tmc3 n/a
6 TRCN0000069512 CAGATCACATCTGCACAGGAT pLKO.1 1358 3UTR 100% 2.640 1.848 N LOC381971 n/a
7 TRCN0000069508 CTTTGGAAGTACAGCCAGCAA pLKO.1 1321 3UTR 100% 2.640 1.848 N LOC381971 n/a
8 TRCN0000069509 AGTGTTTGCTTACAGCTTCAT pLKO.1 1510 3UTR 100% 4.950 2.970 N LOC381971 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785530.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.